                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:79 nt.     Distance to run of Ts=2 nt.   Size=18 nt.     Delta G= -7.00 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -5.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCAAATTTATAGATGTTTTACCAGGAATCGTGGTGACAATGTCGGTGTGGTTTATGG
CTTCTCTTGCTTTTGCGCAGTATTTGACAATGTTTGATTATATTTCTACCTATGCGGG
ATTAGCATCTATTATGGTTGCTATTATTTTTCTTTACATTTTAAGCGCTATTTTTATT
CTTGGAGGCGAAATAAATGCAGCGATAATGTTTTATCGCAATTATTTGCACCATTCGG
ATGAATGAaagaacttatttttgtgtgaaagccaagagacgaaaacacgaaaaaaaccagccatcactTTG

    BH16190 Gene: BH16190     GI: 49476271     BI number: BH16190     GOG: COG1671     Description: hypothetical protei AG G  G GC TG TA C  | TA TA AT TA TA        GT TA       T  T T  T       AT T  G       AT A  C       TA TA        AT CG        GC GC        CG CG        GC             AATTATTTGCACCATTCGGATGAATGAaagaacttatttttgtgtgaaagccaagagacgaaaacacgaaaaaaaccagccatcactTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1671 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................