Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:133 nt.     Distance to run of Ts=1 nt.   Size=25 nt.     Delta G= -6.70 kcal/mol
Antiterminator: Size=71 nt.     Delta G=-11.72 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G= -6.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

acatcttagggcgtatctccaagtttgcggtaagagtcaaatgtcgtttggtgtggtttataggtgcgtgcctctgttttatcaaaaatatcgacagtta
gcgtgtactaatcttattgtttttggttcttgatgagcaaaattttttgcttcattctcttttattttgatataaagttaaagcttgaccgtgtggatta
ctgccctttatacatggaaaatgtttattttttagatccttggtgatttttataaagcttggatagactaaagaaggatttttccagaaagtattaagat
TTG

    BH16200


Gene: BH16200     GI: 49476272     BI number: BH16200     GOG: COG1295     Description: Ribonuclease RNAse bn transmembrane protei


           tg
          g  t
          c  a
           gc
           at
           ta
           ta
           gt
          a  c
          c  t
          a  t
          g  a
          c  t
          t  |
           at
           tg
  a        at
a  a       at
c  a       at
 ta        at
 at        at
 ta        cg
|  t       tg
t  c       at
 tg       |  t       tt
 ta       t  c      a  t
 gc       t  t       at
 ta       t  t       at
 cg       t  g       at
t  t      g  a       cg
c  t      t  t       gc
c  a       cg       |  t
g  |       ta        at
 tg       c  |       gc
 gc        cg        ta
 cg        gc        at
 gt        ta        gt
                        ctcttttattttgatataaagttaaagcttgaccgtgtggattactgccctttatacatggaaaatgtttattttttagatccttggtgatttttataaagcttggatagactaaagaaggatttttccagaaagtattaagatTTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG1295 Predicted membrane protein ... can be seen here

    ..................................................................................................................