                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:61 nt.    Distance to gene:97 nt.     Distance to run of Ts=1 nt.   Size=25 nt.     Delta G= -7.20 kcal/mol
Antiterminator:    Distance from promoter:35 nt. Size=32 nt.     Delta G= -7.40 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G= -3.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGGAC-TATATT. It has a score value of 73.63 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGACTGTTAAAGGAAAAAGATTATATTTCTATAATAATTCAGGACGTATTGTTGTT
ACCCTTTATTCTTCTAATGTTGATCGTTTTGAGGGATACACACTTGATGGTTATCCCG
TTGTTTTAAGCCGTTAGatcatctttagccatttatgaaaaaaaacagatatattaaggaagtcttgaatttcattgatggcagttga
aaaaaggttgtttggATG

    BH16580 Gene: BH16580     GI: 49476307     BI number: BH16580     GOG: COG1485     Description: hypothetical protei TT A  G T  T GT CG AT GT G  A A  C C  C T  C        G T  T      T  A AT       T  T AT        GC TA        TG         T AT        AT       T  G AT        AT       C  A T  C      |  T       AT A  T      T  T       CG T  T       CG       A  G C  C       TA       C  T T  T       TG        AT TA        CG        TA TA        TG        AT AT        TA        GC TG        AT        GC AT        TA        GC                         GTTGTTTTAAGCCGTTAGatcatctttagccatttatgaaaaaaaacagatatattaaggaagtcttgaatttcattgatggcagttgaaaaaaggttgtttggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1485 Predicted ATPase ... can be seen here     ..................................................................................................................