Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:167 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -7.20 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -4.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

catattttttcttaacctatttgagaatagtgtatcacgtaagttctttaaaatattattaattttttttatgaatgattttcttttaaaaagttttatg
aatcatttcaatttgtagaagtgattattttttatatggttgtagaattgtatatggaaaataaatcttatgaaggacacttgcagtttaggaaagttaa
gtatagaatattcctaccttactaaaagtgttctattctttaaatttcccataaattgattttaaaaaacaatttccccacctactaaagagcgtatttc
ATG

    rho --- thdF


Gene: rho     GI: 49476319     BI number: BH16700     GOG: COG1158     Description: Transcription termination factor rho
Gene: thdF     GI: 49476318     BI number: BH16690     GOG: COG0486     Description: Thiophene and furan oxidize


 ag
a  t
 at
 at
 at
 ta
t  t
t  |       tt
t  |      t  g
c  |      a  t
t  |      a  a
 tg        cg
 ta        ta
 ta        ta
 at        tg
 gc        at
 ta        cg
 at        ta
 at        at
 gt        at
            attttttatatggttgtagaattgtatatggaaaataaatcttatgaaggacacttgcagtttaggaaagttaagtatagaatattcctaccttactaaaagtgttctattctttaaatttcccataaattgattttaaaaaacaatttccccacctactaaagagcgtatttcATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG1158 Transcription termination factor ... can be seen here
[R] COG0486 Predicted GTPase ... can be seen here

    ..................................................................................................................