Gene putatively regulated by attenuation in B_henselae_Houston-1
Characteristics of the secondary structures
Terminator: Distance from promoter:38 nt. Distance to gene:162 nt. Distance to run of Ts=2 nt. Size=37 nt. Delta G=-10.90 kcal/mol
Antiterminator: Distance from promoter:15 nt. Size=39 nt. Delta G= -6.16 kcal/mol
Nomenclature/Definitions
The most likely promoter is: ttgtta-taaagt. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
ttgttagatgttgttgttagcattaaagttctctcaaaacaataagggtaatttgcaagttttatgaagaagccggttgctttgtttacggagatagggc
ttttccttttgtgggtatcgtttttgttgtttctgtaagttattccttagcagagaaaagctttgaaaagctctttcttgtagagaaatgcaacaaaatt
aaaaaaaatgtgtttttctcttgcacttctgttgtgaaaattttagggaatatgcatcaagtaaatgtaaatggCGG
_v23
Gene: _v23 GI: BH09530 BI number: BH09530 GOG: ------- Description: tRNA-Pr
a
t t tt
t g t a
t a gc
t a tg
g g tg
a a ta
a a cg
cg g a
gc t t
t c t a
t g g g
tg g |
at cg
at cg
tg gc
gc at
gt at
gt gt
at at
ccttttgtgggtatcgtttttgttgtttctgtaagttattccttagcagagaaaagctttgaaaagctctttcttgtagagaaatgcaacaaaattaaaaaaaatgtgtttttctcttgcacttctgttgtgaaaattttagggaatatgcatcaagtaaatgtaaatggCGG
..................................................................................................................