Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:91 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -6.80 kcal/mol
Antiterminator: Size=78 nt.     Delta G=-11.73 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aaaggtgatcctacaattagagatttaccaacttttcttatttaagttgtatttgtagcgttgataatgaaagcaacgagtagtgatctttattcttacg
atgaacacacaaatgtggcttttattggaagttaggactactctcttagattcatacgctttatgaactcaatttacaattatggtggccattttttagc
cgcttttttatatattattgtcctttcctagtgatatatttcactttcaacttattcaacgtcacacttgtagtgaaatttttttctattagcagatacc
ATG

    BQ00510


Gene: BQ00510     GI: 49473735     BI number: BQ00510     GOG: COG1514     Description: ABC transporter (permease


  c
g  t
c  t
 at
 ta
 at
 cg
 ta
 ta
a  |
g  |
a  |
t  |
t  |
c  |
t  |
c  |
t  |
c  |
a  |
t  |
c  |
a  |
 gc
 gt
a  c
 ta
 ta
 gt
 at
 at
g  a
 gc
 ta
 ta
 at
|  t
|  a        t
|  t      t  t
t  g      t  t
t  g      a  t
t  t      c  a
 tg        cg
 cg        gc
 gc        gc
 gc        tg
 ta        gc
 gt        gt
            tttttatatattattgtcctttcctagtgatatatttcactttcaacttattcaacgtcacacttgtagtgaaatttttttctattagcagataccATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG1514 2'-5' RNA ligase ... can be seen here

    ..................................................................................................................