                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:213 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-12.80 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -3.10 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G= -3.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAACGGGCGCATATCTGCGTCGTTGAatctcttttttatcggattattttataaagcgggagcacttttgagtgctctctt
attttttggcattcaagatctatagagcttcttgaaagaggttttccgtatcaaagcacaggctctcttttaaatcatcaattttttttaagacaaaaaa
gaatgtttttaaacatcttgaaaagttatttttttgtcagaattcttcattgcaaaagtgaaaaataactgttatttctaaatggtaatgcaaatcattg
gcaataaagagaggatccaATG

    yfeA --- yfeB --- yfeC --- yfeD Gene: yfeA     GI: 49473762     BI number: BQ00790     GOG: COG0803     Description: Iron transport protein yfeA Gene: yfeB     GI: 49473763     BI number: BQ00800     GOG: COG1121     Description: Iron transport protein yfeB Gene: yfeC     GI: 49473764     BI number: BQ00810     GOG: COG1108     Description: Iron transport system membrane protein yfeC Gene: yfeD     GI: 49473765     BI number: BQ00820     GOG: -------     Description: Iron transport system membrane protein yfe            ta           t  t            at            gt            gt tt       c  | c  t       ta t  t       at        tt c  t       ta       t  g Gt        ta        ta Ta        ta        cg At        tg        at a  c      |  c       cg cg        tg        gc cg        tg        at ta        cg        gc at        ta        gt gt        cg        gc                         ttattttttggcattcaagatctatagagcttcttgaaagaggttttccgtatcaaagcacaggctctcttttaaatcatcaattttttttaagacaaaaaagaatgtttttaaacatcttgaaaagttatttttttgtcagaattcttcattgcaaaagtgaaaaataactgttatttctaaatggtaatgcaaatcattggcaataaagagaggatccaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0803 ABC-type metal ion transport system, periplasmic component/surface adhesin ... can be seen here [P] COG1121 ABC-type Mn/Zn transport systems, ATPase component ... can be seen here [P] COG1108 ABC-type Mn2+/Zn2+ transport systems, permease components ... can be seen here     ..................................................................................................................