                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:210 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-15.40 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -4.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gaatgcagtatgtattctctccccccccttaaaaaactgcattcgttaattaagaggctgcattgatttattctgcagcctttttttattttgggatttc
ctaaaaatttattctggttccttgaaaactttggaataatcatcatattgcaaaagctattcttatgttttggaagaagtgatcacagaaaatacgctta
cgaataaagtggtattgtggaggagtctgtttgtgcgctaaagcgtgtgaaaaataggagaatgtataatgttttttgtagcggaaaataacgctggaag
ATG

    BQ00830 Gene: BQ00830     GI: 49473766     BI number: BQ00830     GOG: COG2832     Description: hypothetical protei             t   a       t  a c  t      t  t g  t       at t  c       gc cg       t  | at       t  | at        at a  a       cg a  a       gc at        ta at        cg ta        gc ta        gc cg        at c  a       gt cg        at cg        at             tttattttgggatttcctaaaaatttattctggttccttgaaaactttggaataatcatcatattgcaaaagctattcttatgttttggaagaagtgatcacagaaaatacgcttacgaataaagtggtattgtggaggagtctgtttgtgcgctaaagcgtgtgaaaaataggagaatgtataatgttttttgtagcggaaaataacgctggaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2832 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................