                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:144 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-11.20 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGAAGGAAAAGAAGCTGTTGCACATTACGGTTCTACAGACTCAGGTGCTTCTCTTGGC
GATATTCTCGGTGCAGCTTTGAAAAAACAAGAACAAGATTAAtatgattcaataaattaaacttaggtc
gcttgtttctctggcggcctttttttattttccaatgaaactgctctgttgatttttcaatgcctggtttaaaaattgtaaatactttcagatacaaatc
ttattattagaatagaaatgccaacaacctattgaataaaagaaaccacctaattgaatagcaataaaatattATG

    BQ00850 Gene: BQ00850     GI: 49473768     BI number: BQ00850     GOG: COG3459     Description: Cyclic beta 1-2 glucan synthetas   a a  t c  a ta ta at gt ta |  a a  a t  c At At         t Ta       t  c Tg       t  t |  g      g  c |  t      t  t |  c       tg A  g       cg Gc        gc At        cg At        tg Cg        gc At        gc At        at             ttttttattttccaatgaaactgctctgttgatttttcaatgcctggtttaaaaattgtaaatactttcagatacaaatcttattattagaatagaaatgccaacaacctattgaataaaagaaaccacctaattgaatagcaataaaatattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG3459 Cellobiose phosphorylase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_quintana_Toulouse                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:151 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -6.30 kcal/mol Antiterminator: Size=45 nt.     Delta G= -3.90 kcal/mol Anti-antiterminator:   Size=39 nt.     Delta G= -4.70 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TGAAGGAAAAGAAGCTGTTGCACATTACGGTTCTACAGACTCAGGTGCTTCTCTTGGC GATATTCTCGGTGCAGCTTTGAAAAAACAAGAACAAGATTAAtatgattcaataaattaaacttaggtc gcttgtttctctggcggcctttttttattttccaatgaaactgctctgttgatttttcaatgcctggtttaaaaattgtaaatactttcagatacaaatc ttattattagaatagaaatgccaacaacctattgaataaaagaaaccacctaattgaatagcaataaaatattATG     BQ00850 Gene: BQ00850     GI: 49473768     BI number: BQ00850     GOG: COG3459     Description: Cyclic beta 1-2 glucan synthetas             a           g  t           t  t            ac   C        ta G  A       Aa T  G       At GC        Ta GT       |  a C  T      T  a T  T      A  t CG        Gt TA        Aa TA        Aa A  A       Ca         t T  A      |  c      t  c A  A      |  t      t  t G  A      |  t      g  c C  |      A  a      t  t G  |       Ag        tg GC        Gg        cg TA        At        gc TA        Ac        cg CG        Cg        tg TA        Ac        gc                         ctttttttattttccaatgaaactgctctgttgatttttcaatgcctggtttaaaaattgtaaatactttcagatacaaatcttattattagaatagaaatgccaacaacctattgaataaaagaaaccacctaattgaatagcaataaaatattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG3459 Cellobiose phosphorylase ... can be seen here     ..................................................................................................................