                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:33 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G= -6.40 kcal/mol
Antiterminator: Size=64 nt.     Delta G=-12.70 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -8.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATCTTATCGTCAGCTTTCCATTGTGCCTCGTATGGGTGATATTGCTGCGAAGGAAAA
GGATGCTGAAATACGTTATTTTGCCCCTGTTGAGAAGGGGCTTTACTACCGGATTGTC
AACCGATGTGTCGATGAAAATACAGTATGTAATGAAGATTTAATGAAGCGTGCTGCTG
CTCAGACACTTTGGGGTGCACTTTGTTCTGTTTTTGATCCTGGTGTTATTTAAaatattaa
tagaaaaagagccctttgaaaaagagggttctttaaactgaaatttatctgatacgggttgagaaATG

    cyoB --- cyoC --- cyoD Gene: cyoB     GI: 49473793     BI number: BQ01160     GOG: COG0843     Description: Cytochrome o ubiquinol oxidase subunit I Gene: cyoC     GI: 49473794     BI number: BQ01170     GOG: COG1845     Description: Cytochrome o ubiquinol oxidase subunit III Gene: cyoD     GI: 49473795     BI number: BQ01180     GOG: COG3125     Description: Cytochrome o ubiquinol oxidase subunit I            TT           T  A           A  A            Ta            Ta            Gt            Ta            Gt            Gt            Ta           C  |           C  |           T  | TG       A  | T  T      G  | T  T      T  | C  C      T  | AT       T  | CG       T  | GT        Ta |  T       Gt |  T       Ta |  T       Cg |  T       Ta |  G       Ta TA       G  | GT        Ta GC        Ta GC        Ta GT        Cg         a T  |      A  a      a  a T  |      C  |      g  a TG       G  |       ta CG        Tg        tg AT        Gc        ta CG        Gc        cg AT        Gc        cg GT        Gt        cg                         ttctttaaactgaaatttatctgatacgggttgagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0843 Heme/copper-type cytochrome/quinol oxidases, subunit 1 ... can be seen here [C] COG1845 Heme/copper-type cytochrome/quinol oxidase, subunit 3 ... can be seen here [C] COG3125 Heme/copper-type cytochrome/quinol oxidase, subunit 4 ... can be seen here     ..................................................................................................................