                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:124 nt.    Distance to gene:23 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -7.90 kcal/mol
Antiterminator:    Distance from promoter:104 nt. Size=30 nt.     Delta G= -3.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tagaat-tataat. It has a score value of 75.64 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tagaataatcgttgtatccttgttataattttaaaattatttgatgaggattcctgttacattcaaaaagctatgtgttatctgaatgagggtgtagcta
tacgtgtttgcgtacgattgctgtcttattcttgagtgtcttggaagttgtcagaattagctcttttagggttgattttttttcgaattgtgaaagttaa
agaaaATG

    nrdH --- nrdI --- nrdE --- nrdF Gene: nrdH     GI: 49473847     BI number: BQ01800     GOG: COG0695     Description: Glutaredoxin-like protein nrdH Gene: nrdI     GI: 49473848     BI number: BQ01810     GOG: COG1780     Description: nrdI protein Gene: nrdE     GI: 49473849     BI number: BQ01820     GOG: COG0209     Description: Ribonucleotide reductase alpha-chain Gene: nrdF     GI: 49473850     BI number: BQ01830     GOG: COG0208     Description: Ribonucleotide reductase beta-chai gt a  t a  g gt gc         t t  |      t  t ta       t  a cg        cg ta        tg |  a       cg |  t       gt |  t       at g  a       tg tg        ta gc        at at        at gc        gt             tttttcgaattgtgaaagttaaagaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0695 Glutaredoxin and related proteins ... can be seen here [F] COG1780 Protein involved in ribonucleotide reduction ... can be seen here [F] COG0209 Ribonucleotide reductase, alpha subunit ... can be seen here [F] COG0208 Ribonucleotide reductase, beta subunit ... can be seen here     ..................................................................................................................