                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:132 nt.    Distance to gene:22 nt.     Distance to run of Ts=2 nt.   Size=31 nt.     Delta G=-11.60 kcal/mol
Antiterminator:    Distance from promoter:118 nt. Size=29 nt.     Delta G= -4.10 kcal/mol
Anti-antiterminator:    Distance from promoter:86 nt.    Size=44 nt.     Delta G=-18.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttaaa-taaaat. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttaaaaattttcataaaacattattaaaatcaatctttcaaaataaaagcctttattaaagaagatcttcaagatgctttcaaggactagtattctaac
ctccttttctgtatataatgccagagcaagtaagagtctttgactcttcttgttctttcgtagacccttgctgaacgacatctcggctgtgggtgacttt
tttcttcgttttttgaaaggataatacgATG

    rpsO Gene: rpsO     GI: 49473866     BI number: BQ01990     GOG: COG0184     Description: 30s ribosomal protein s1   t t  t cg ta gc at gc at        cc        ac at       a  c      g  a t  |       gt       c  t gc        at       a  c at        tg        at at        gc        gc cg       c  t       tg gt       t  |       cg at       t  |       gc gc       t  |      |  t at        cg       t  g c  t       ta       t  t c  t       ta        cg gc        gc        cg tg        tg        cg at        ta        at                         gacttttttcttcgttttttgaaaggataatacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0184 Ribosomal protein S15P/S13E ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_quintana_Toulouse                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:95 nt.    Distance to gene:72 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-10.10 kcal/mol Antiterminator:    Distance from promoter:61 nt. Size=45 nt.     Delta G= -3.70 kcal/mol Anti-antiterminator:    Distance from promoter:43 nt.    Size=40 nt.     Delta G= -5.70 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: tttaaa-taaaat. It has a score value of 66.93 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tttaaaaattttcataaaacattattaaaatcaatctttcaaaataaaagcctttattaaagaagatcttcaagatgctttcaaggactagtattctaac ctccttttctgtatataatgccagagcaagtaagagtctttgactcttcttgttctttcgtagacccttgctgaacgacatctcggctgtgggtgacttt tttcttcgttttttgaaaggataatacgATG     rpsO Gene: rpsO     GI: 49473866     BI number: BQ01990     GOG: COG0184     Description: 30s ribosomal protein s1             t           a  a            ta            at at        tg t  t      |  c gc        gc at        ta ta        cg |  a       ta |  c       tg c  c      t  c        t at       t  a      t  t gc       c  a       cg gc       c  |       ta at       t  |       gc at       c  |       at c  t       cg        gc t  t       at        at t  c      a  a       at t  t       ta       t  | cg        cg        gc gt        ta        at ta        tg        at at        at        cg                         ttctttcgtagacccttgctgaacgacatctcggctgtgggtgacttttttcttcgttttttgaaaggataatacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0184 Ribosomal protein S15P/S13E ... can be seen here     ..................................................................................................................