                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:14 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-12.90 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-14.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTATGCAAACTGGACTCTATACTATTTTACACACCATCATAGCTTTGAATGGGAAGC
AGAAAATCTTAAGGATTGGAAAACTCCTTATCCGCTATGGCCAGGCACCCGCTATGAA
GAAAAAGCTTTACGCGAGGGACGAACACCTACCTATCTGACTTTTATAAAGAAATAAa
tgatgaaacacttttcttataaacaccttgaaaaaatttgaatttaagagtatcaatgggcaaattcttggtcttatgatgaggagtgggccgtctggac
ccgcttttttttatatcataaaactgATG

    BQ02060 Gene: BQ02060     GI: 49473873     BI number: BQ02060     GOG: COG0779     Description: hypothetical protei ta t  t cg ta        tc gt       g  t g  g       cg ta        cg tg       |  a cg        gc ta        gc tg        gc at        tg a  g       gc a  g       at cg        gt gc        gt gc        at             ttttatatcataaaactgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0779 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................