Gene putatively regulated by attenuation in B_quintana_Toulouse
Characteristics of the secondary structures
Terminator: Distance from promoter:95 nt. Distance to gene:65 nt. Distance to run of Ts=0 nt. Size=25 nt. Delta G= -6.90 kcal/mol
Antiterminator: Distance from promoter:60 nt. Size=46 nt. Delta G= -4.30 kcal/mol
Anti-antiterminator: Distance from promoter:29 nt. Size=50 nt. Delta G= -3.70 kcal/mol
Nomenclature/Definitions
The most likely promoter is: ttgcta-tacatt. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
ttgctaaacatccgtttggtattttacatttgacggtgcattgtgttcttattggttacaaaatcagtgatttctatgttggtatagcttaagaattccc
atttattttaaaattaaagtgctgcagggctttgttttttagagagctctcttttttctatggaaatttgaagcgagggcactagataaaatccattatg
gatattatatggagataaatctATG
BQ02400
Gene: BQ02400 GI: 49473902 BI number: BQ02400 GOG: ------- Description: hypothetical protei
t
g a
gt
ta aa
tg a t
gc at
| t ta
t t ta
a a ta
ta tg
cg at
ta tg
ta | c
| t | t
| t t g t
t c t c t t
a c a a t t
gc cg t a
ta cg g g
gt cg ta
at t c tg
c t t t ta
ta at cg
at at gc
at g g gt
at at gc
at at at
cttttttctatggaaatttgaagcgagggcactagataaaatccattatggatattatatggagataaatctATG
..................................................................................................................