Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:125 nt.    Distance to gene:80 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G= -9.10 kcal/mol
Antiterminator:    Distance from promoter:124 nt. Size=21 nt.     Delta G= -5.70 kcal/mol
Anti-antiterminator:    Distance from promoter:81 nt.    Size=53 nt.     Delta G=-10.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: gtgata-tattat. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtgatactattgtacaggactcatattatcatgcaggcagaatatcgttacacgttgatttttataaaaggaaatttgtaaacaacaaataggagtttaa
ctgtaactccaatagcttcggcatatatgtaacttacaaactttcctgtagaacgaagttgttaagaggcttcgtctttaacaaggcttctattttcata
actgtgtcgtttttactacagatttttttgcataggtgtgtaacatatgcttcataaataaaggagcaaagtttATG

    hbpA


Gene: hbpA     GI: 49473904     BI number: BQ02420     GOG: -------     Description: Hemin binding protein


  c
a  t
 at
 ta
 gc
 ta
|  a
|  a
|  c
|  t
|  t
|  t                  t
|  c                t  c
|  c                 cg
 at                  gt
 tg                  gc
 at                  at
 ta                  gt
a  g                a  |
c  a                 at
g  a        a        ta
 gc       t  a       ta
 cg       t  g       gc
 ta       g  a       ta
 ta        tg       |  a
 cg        tg       |  g
 gt        gc        tg
 at        at        gc
 tg        at        at
 at        gc        at
 at        cg        gc
                        tattttcataactgtgtcgtttttactacagatttttttgcataggtgtgtaacatatgcttcataaataaaggagcaaagtttATG


    ..................................................................................................................