                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:89 nt.     Distance to run of Ts=2 nt.   Size=28 nt.     Delta G=-11.10 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -5.50 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G= -3.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgataatgtgttgaaaaaggcggtatattttaccggccacacctattgcttttatttgtagagtgtttcaattttcaatatctgaagaattgcgaaaaaa
agaaagtcttttcaatagtacaaggattttttctgtttaatgttcataaacataaatatgagtggtgtttatattatgtactttcttgcggtagggagta
cgttcttatttagataattgccatctttggtagcgatcttttgtgttaaaggatttacgtgaggtgcaatggactatttgcatgttgtggagagagattg
ATG

    pyrD Gene: pyrD     GI: 49473938     BI number: BQ02890     GOG: COG0167     Description: dihydroorotate dehydrogenas             g           a  t           g  g            tg at        at c  a       tg ta        at ta        at        cg gc        at       g  g ta        ta       t  t a  |       at        ta at       c  a       cg ta       a  |      t  g ta        at       t  g ta        at        ta gt        ta        cg ta        at        at |  t       cg        ta cg       t  t       gc ta        ta        tg tg        gc        at                         tcttatttagataattgccatctttggtagcgatcttttgtgttaaaggatttacgtgaggtgcaatggactatttgcatgttgtggagagagattgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0167 Dihydroorotate dehydrogenase ... can be seen here     ..................................................................................................................