Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:88 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-15.70 kcal/mol
Antiterminator: Size=65 nt.     Delta G= -8.60 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-11.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGGACTTGGGAATATTTTTGGTAGCTATCTTTCTGGTGCATTACGTAATCCATCGGC
AGCAGATAGTCAGTTTGGTCGTCTCGTCTTTGGTTTTGCTGTGACAGAGGCTTTGGGT
ATTTTTTCATTGCTTGTTGCTTTGTTGCTTCTTTTTGCGGTTTAAtcatttttgaaagggtatacct
gctttctttatgagggcgggcatgctcttttggtgttgtaacggaaggagcgttagtcggctgtcgttcgttttgaataaagcgccttaagccaggctgt
ttgaaggatgagagaaaATG

    atpF1 --- atpF2


Gene: atpF1     GI: 49473961     BI number: BQ03150     GOG: -------     Description: ATP synthase B chain
Gene: atpF2     GI: 49473962     BI number: BQ03160     GOG: -------     Description: ATP synthase B chai


            C
          T  T
          T  T
          C  T
          G  T
          T  T
           TG
           GC
           TG
  T        TG
T  T      T  T
T  C      C  T
T  A       GT
T  T       TA
 AT        TA
 TG        Gt
 GC       T  c        t
 GT       T  a      t  a
 GT       C  t      t  t
 TG       G  t       cg
T  T      T  t       ta
T  T      T  t       tg
 CG        At        tg
 GC        Cg        cg
G  |       Ta        gc
 AT        Ta        tg
 GT        Ta        cg
 AT        Tg        cg
 CG        Tg       a  c
 AT        Tg        ta
 GT        At        at
 TG        Ta        tg
 GC        Gt        gc
                        tcttttggtgttgtaacggaaggagcgttagtcggctgtcgttcgttttgaataaagcgccttaagccaggctgtttgaaggatgagagaaaATG
    ..................................................................................................................