                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:137 nt.    Distance to gene:52 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -6.70 kcal/mol
Antiterminator:    Distance from promoter:77 nt. Size=74 nt.     Delta G=-11.00 kcal/mol
Anti-antiterminator:    Distance from promoter:37 nt.    Size=72 nt.     Delta G= -9.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-AAAAAT. It has a score value of 69.61 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAAAAACGCCTTGATGATTTGGAAAAAATGCAGACACCAAAAAAATAAaatggtttcca
taaaataagactcttagaaaaaatatccccaatttttcaatatgatgtatgaaactgaaaaatgcttaatcttgagtctgttagaacagattgtccgttt
gttttcagagtggtttttataaaaaaagcactttttttgaatcaaggggctagcgccttgagattgtatcaatacactgaaaaggcttgATG

    BQ03360 --- BQ03370 Gene: BQ03360     GI: 49473980     BI number: BQ03360     GOG: -------     Description: hypothetical protein Gene: BQ03370     GI: 49473981     BI number: BQ03370     GOG: COG5465     Description: hypothetical protei             t           g  t           t  a gt        cg t  a       ta a  t      g  a g  g      a  c t  a      g  | a  a      t  | t  a       ta a  c       cg at        ta cg        at ta        at ta        tg ta       |  t ta       |  c ta       t  c at        cg a  g       gt c  c      |  t c  t      t  t c  t      a  g c  a       at t  a       at a  |       at t  |       at a  |       gc a  |       ta a  |       cg a  |      |  a       ta a  |      |  g      a  a at       |  t       ta gc       |  g       ta at       |  g       ta t  t      |  t       ta t  |       at        ta cg        at       g  g ta        at        gc cg        gt        ta at        ta        gc gc        at        at at        ta        gt                         tttttgaatcaaggggctagcgccttgagattgtatcaatacactgaaaaggcttgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG5465 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................