                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:150 nt.    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -7.60 kcal/mol
Antiterminator:    Distance from promoter:116 nt. Size=43 nt.     Delta G=-10.70 kcal/mol
Anti-antiterminator:    Distance from promoter:83 nt.    Size=53 nt.     Delta G= -4.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tggaat-taatat. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tggaatattgcaaggtaagaggcgtcgtaatatcgtttataggaacggattttatcagtttcttttttataaaatgaattaaaatgagaaaagctgtaga
taattccacatcgataaagtattccgatggaaatgcaccacaccataaacgaaagagtggagaaggcttattcttaccgtttcactctcttgataaaata
atataagggagttttttTTG

    dxs Gene: dxs     GI: 49473998     BI number: BQ03540     GOG: COG1154,COG3958     Description: 1-deoxyxylulose-5-phosphate synthas ca g  c t  c a  a a  c a  a gc gc ta at |  a |  a       tt |  a      a  c |  c      t  t |  g      t  t |  a      c  a |  a       gc |  a       gc |  g      a  g       at |  a      a  |      a  a |  g       gt       a  a gt        at        at cg        gt        ta cg        gc       a  | ta        ta        gt tg        gc        ta |  a       at        ta |  a       gc        cg a  g       at        tg tg       a  c       cg gc        at        ta at        gt        cg at        cg        at                         tttttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [HI] COG1154 Deoxyxylulose-5-phosphate synthase ... can be seen here [G] COG3958 Transketolase, C-terminal subunit ... can be seen here     ..................................................................................................................