Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:174 nt.    Distance to gene:22 nt.     Distance to run of Ts=3 nt.   Size=32 nt.     Delta G=-10.40 kcal/mol
Antiterminator:    Distance from promoter:148 nt. Size=40 nt.     Delta G= -6.80 kcal/mol
Anti-antiterminator:    Distance from promoter:110 nt.    Size=57 nt.     Delta G=-13.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGACC-AAAGAT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGACCGCATCAAGATTGAACAAAGATGCGTTTCTGTTCTGAACGATCACCTGCAGAC
GAAGTTAGCTTTGAGTGAAAAAGACAAAAAATGCGTGGAAAAAATGCTTGAGGGGGTT
GAAAATGAAAGCTTACGCCAATCACTTTATGAACTTGGCTGTTGCATTTTTGCAGAAA
AAAAGAGTAAATAGagtagagtatcttccctatttttctttagtataaagagtatagggttcttatttttttaataacaacagaaaagta
ttatttATG

    BQ03750


Gene: BQ03750     GI: 49474015     BI number: BQ03750     GOG: -------     Description: hypothetical protei


 TT
T  T
 AT
 CG
 GC
 TA
 TG
|  A
|  A
G  A        t
T  A      g  a
C  A      a  t
G  A       gc
G  A       at         t
 TG       t  t      g  a
 TA       g  c       at
 CG       a  c       ta
 AT        Gc        ta
A  A       At        ta
G  A       Ta        cg
 TA        At        ta
 AT        At        tg
 TA        At       t  t
 TG       T  |      t  |
 Ta        Gt        ta
 Cg        At        at
 At        Gc        ta
|  a       At        cg
 Cg        At        cg
 Ta        At        cg
                        ttcttatttttttaataacaacagaaaagtattatttATG


    ..................................................................................................................