                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:112 nt.    Distance to gene:115 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -7.40 kcal/mol
Antiterminator:    Distance from promoter:50 nt. Size=71 nt.     Delta G= -6.51 kcal/mol
Anti-antiterminator:    Distance from promoter:40 nt.    Size=50 nt.     Delta G= -5.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: GTGTTA-TTTATT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGTTACAGCAACACCTACCTTTTTTATTAATGGTAATAAATATACAGGTGTGATGTC
GGTAGAAGCCTTCTTTTCGGTGATTGATAGTTTTCTTAAAAACTAAattttctttaaaagatgtgt
atttatatctgtgatcattattcttcttttgggggagaatggtttttgcagttgatgaaacaatatttctttggtttagccaattttgaatcaaatcatt
actgttgatgattagcctggctcaaatgatgttttgatgctgatatgggaggatttgtacgATG

    ppdK Gene: ppdK     GI: 49474016     BI number: BQ03760     GOG: COG0574     Description: Pyruvate phosphate dikinas            at           t  t            gt            ta            gt            ta            at            gc            at           a  g           a  t           a  |           t  |           t  |           t  |           c  |           t  |           t  |           t  |           t  | TT       a  | C  A      A  | TA       A  | TA       T  | TA       C  | TA       A  | GC       A  | AT       A  | TA       A  | |  A      A  | A  a      T  | G  t      T  | T  t       Cg T  t       Ta         t At       T  t      t  g Gc       T  c      t  g T  t       Ta        tg G  t       Gt        cg G  t       At        tg C  |       Ta        ta Ta        At        cg Ta        Gt        ta Ta       T  c       ta Ta       T  t       at Cg        At        tg Ta        Gc        tg                         tttttgcagttgatgaaacaatatttctttggtttagccaattttgaatcaaatcattactgttgatgattagcctggctcaaatgatgttttgatgctgatatgggaggatttgtacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0574 Phosphoenolpyruvate synthase/pyruvate phosphate dikinase ... can be seen here     ..................................................................................................................