                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:109 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-14.00 kcal/mol
Antiterminator: Size=35 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -4.45 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTAAATTGTTACAGCGTTATATTTCAGAACGTGGGAAAATTGTTCCTTCACGGATTA
CAGCTGTTAGTCAGAAAAGACAGCGTGAATTGGCTAATGCTATCAAACGTGCTCGTTT
TCTTGGTTTGCTTCCATACGTTATAAAATAAtatcagatgcactctgcagctggggattttctccagccgcttttct
catatgggtcagcaacacacttaacttgcctactatacgaagatagataaaataccaaagttggagcattacaacgctcctaactgcagaaagcaggaca
gcaataaATG

    BQ04480 --- rplI Gene: BQ04480     GI: 49474086     BI number: BQ04480     GOG: NOG05854     Description: hypothetical protein Gene: rplI     GI: 49474085     BI number: BQ04470     GOG: COG0359     Description: 50s ribosomal protein l   G T  C T  T T  T GC GC TA T  T C  | T  | T  | T  | TA GC CG |  T |  T |  A |  T |  A        t |  A      c  c |  A      a  t |  A       cg |  T       gc |  A       ta |  A      a  g        t |  t       gc       t  t |  a       at       a  t |  t       cg        gc |  c       tg        gt |  a      a  g       gc |  g      t  g       gc |  a      A  |       ta T  t      A  |       cg Cg        Ta        gc Gc        At       a  c Ta        At        cg Gc        At        gc                         ttttctcatatgggtcagcaacacacttaacttgcctactatacgaagatagataaaataccaaagttggagcattacaacgctcctaactgcagaaagcaggacagcaataaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0359 Ribosomal protein L9 ... can be seen here     ..................................................................................................................