                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:57 nt.     Distance to run of Ts=3 nt.   Size=34 nt.     Delta G=-15.10 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -4.44 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -7.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGGGTTAATGCAGATAAGGTAGTAGAAAATGCAAGCTTTATCGATGATCTAGGAGC
AGATAGCCTTGATACGGTTGAGCTCGTTATGGCTTTTGAAGAAGAATTTGGTGTAGAA
ATCCCAGATGAAGCCGCTGAAACGATTTTCACAGTTGGTGATGCAGTAAAGTTTATCG
ATAAAGCTTCTGCATGAtacctaaaaggcaaaggcgtaaaattaaaaatgcttttgcctgtattctttgaggactattttgagaaaag
agctttgaggagtgaatctcaattcaaggttaagagttATG

    fabF1 Gene: fabF1     GI: 49474093     BI number: BQ04550     GOG: COG0304     Description: 3-oxoacyl-[acyl-carrier-protein ] synthase I   G                  tt C  A                a  a T  T       cc       a  a A  A      a  t      a  a TA       t  a      a  a TA       A  a       ta TG       G  a       gt GC       T  a       cg AT       A  g       gc AT        Cg        gt A  |       Gc        at T  |       Ta        at GC       C  a       at AT        Ta        cg CG        Tg        gc GC        Cg        gc TA        Gc        at                         gtattctttgaggactattttgagaaaagagctttgaggagtgaatctcaattcaaggttaagagttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQ] COG0304 3-oxoacyl-(acyl-carrier-protein) synthase ... can be seen here     ..................................................................................................................