                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:197 nt.     Distance to run of Ts=1 nt.   Size=31 nt.     Delta G= -8.70 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -5.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTCAGGAGCCGGGTGGTCAAGGTGATTCATCTGGGGGACAACGTCAATTTGTTGAAG
TTTTGGCGCGTGCGGCTGTTTCTGTTGGGGTTGCAGGTATTTTCTTAGAAACGCATCA
AGATCCAGATAATGCACCTTCTGATGGACCCAATATGGTTAAAATCGATCATTTACAA
AGACTGCTTGAGACTTTAATGGAATTTGATTATCTGTCAAAAAAGGTGAATTGAatagag
aatatttcgccattatgctgtttgacttaaatcgagacttttgttggattggataaggaaactcacATG

    eno Gene: eno     GI: 49474124     BI number: BQ04880     GOG: COG0148     Description: Enolas GT A  T AT GT TG TG GC TG         T T  C      C  G T  G      T  T A  |      T  T AT       T  G CG       G  G T  |       TG GC        CG CG        GT |  G       GT A  C       CG AT        GC CG        TA AT       G  G GT        CG GT        GT             ATTTTCTTAGAAACGCATCAAGATCCAGATAATGCACCTTCTGATGGACCCAATATGGTTAAAATCGATCATTTACAAAGACTGCTTGAGACTTTAATGGAATTTGATTATCTGTCAAAAAAGGTGAATTGAatagagaatatttcgccattatgctgtttgacttaaatcgagacttttgttggattggataaggaaactcacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0148 Enolase ... can be seen here     ..................................................................................................................