                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:26 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -6.10 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -5.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCACGCCCTTTATTGTAAACAAAGGGTCTATCGCACTTAATGGGACATCTTTGACTGT
TAATTGTGTTAAAGATCGTATTTTCGATGTTCTTATTATTCGTCATACACTTGAAATG
ACAACTTGGGGACAAGCAAACATTGGAGATCGGGTCAATTTAGAAATTGATCAGCTTG
CCCGTTATGCTGCCAAACTTTCTGGCTTTAAAGTAAAAGATGAGTAAactgaaaatttattatag
tttttaaaatttggtgctctatgagcctaaattgtttggttagtttttgtgagatcccattATG

    ribH --- nusB Gene: ribH     GI: 49474163     BI number: BQ05430     GOG: COG0054     Description: Riboflavin synthase beta chain Gene: nusB     GI: 49474164     BI number: BQ05440     GOG: COG0781     Description: N utilization substance protein tt a  a t  t ta tg at at at at gt ta |  a |  a        a |  a      t  t |  t       cg |  t       ta c  t       cg a  g       gc A  g      t  | At        gc Tg        gt Gc        ta At        ta Gc        ta             ttgtttggttagtttttgtgagatcccattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0054 Riboflavin synthase beta-chain ... can be seen here [K] COG0781 Transcription termination factor ... can be seen here     ..................................................................................................................