Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:193 nt.     Distance to run of Ts=2 nt.   Size=24 nt.     Delta G= -6.20 kcal/mol
Antiterminator: Size=35 nt.     Delta G= -3.44 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atatattggataacttttaaatgatttataaacataatcttctatccttgagtattctccccacctctcaatagacgttactttagtatttcgtcttatg
tttttgtattaaccgcttatgtttttgtattaaccgtggaaaataaaccttgtaattccatatagggtatattttaacaataacaatcacaagttgtata
atattaatgtttttttatgtgttcttaaccaattgccattggctattcctgagaaaggcgtttataaaaaagttttttatttcaacattcgggtaaaatt
ATG

    topA --- vacB


Gene: topA     GI: 49474247     BI number: BQ06420     GOG: COG0550,COG0551,COG1754,COG1110,COG5531     Description: DNA topoisomerase I
Gene: vacB     GI: 49474248     BI number: BQ06430     GOG: COG0557     Description: Exoribonuclease, VacB and RNase II famil


 cc
t  c
c  c
t  a
t  c
a  c
t  t       tt
 gc       t  a
 at        cg
 gc        at
 ta        ta
t  |      |  t
c  |      |  t
c  |      t  t
 ta        gc
 at        cg
 ta        at
 cg        gc
 ta        at
            tatgtttttgtattaaccgcttatgtttttgtattaaccgtggaaaataaaccttgtaattccatatagggtatattttaacaataacaatcacaagttgtataatattaatgtttttttatgtgttcttaaccaattgccattggctattcctgagaaaggcgtttataaaaaagttttttatttcaacattcgggtaaaattATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[L] COG0550 Topoisomerase IA ... can be seen here
[L] COG0551 Zn-finger domain associated with topoisomerase type I ... can be seen here
[R] COG1754 Uncharacterized C-terminal domain of topoisomerase IA ... can be seen here
[L] COG1110 Reverse gyrase ... can be seen here
[B] COG5531 SWIB-domain-containing proteins implicated in chromatin remodeling ... can be seen here
[K] COG0557 Exoribonuclease R ... can be seen here

    ..................................................................................................................