                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:126 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G= -8.40 kcal/mol
Antiterminator: Size=57 nt.     Delta G= -9.10 kcal/mol
Anti-antiterminator:   Size=22 nt.     Delta G= -4.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGATCTTGTAAAAAATGTGAAAAAAGAGATGTCTGAAACACTTCATTTGGAAAATTC
CATTATGCCTACAACGTCTAATTCCTCAGCAAATCCGAAATAAtttaattgatatcatttacaataat
gaatgattccttgtttgtttttgaaagtggcagtttttctgccatttttaataaaagtaggtcttttttacgatgttgctttatataataatgacacttg
agaataaaaagaacttccatttgataacaaatgacaataacttattattgcagacgtataagaaaggatagtttGTG

    gor Gene: gor     GI: 49474275     BI number: BQ06800     GOG: COG1249     Description: Glutathione reductas            tc           t  c            at            gt            tg            at            at           g  t           t  g            at            at           t  t            at            at            cg           a  a            ta            ta            tg at        at a  a       cg c  a       tg         t at       a  |      t  t tg       t  |      t  t ta       a  |       gc ta        gc        at at        ta        cg cg        tg        gc ta        at        gc at        at        ta                         tttttaataaaagtaggtcttttttacgatgttgctttatataataatgacacttgagaataaaaagaacttccatttgataacaaatgacaataacttattattgcagacgtataagaaaggatagtttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1249 Pyruvate/2-oxoglutarate dehydrogenase complex, dihydrolipoamide dehydrogenase (E3) component, and related enzymes ... can be seen here     ..................................................................................................................