                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:118 nt.    Distance to gene:87 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-11.90 kcal/mol
Antiterminator:    Distance from promoter:94 nt. Size=40 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:    Distance from promoter:84 nt.    Size=18 nt.     Delta G= -3.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaat-taatat. It has a score value of 72.29 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaattttaacattgcatgttaatatttattttactacgtttccggtattaagagagtgatgattgttccgaaatctcggggattattattgatttttt
ttgaaggttagctatggaaagcgctatagaagtgaagtgttggatgatagcaagacgagcgacattcgtgtttagtgctgtcatttttttagcttatctc
acaatctgattttaaatgagacaaaggcgataaaaaggcttatactcgaagttggtatttaattttgaggtgatgaGTG

    sdaA Gene: sdaA     GI: 49474304     BI number: BQ07090     GOG: COG1760     Description: L-serine dehydratas             t           a  g           g  a            gt            ta            tg         a            gc       c  t            ta       a  t           g  a       gc           a  g       cg           a  |       gt           g  |      a  g            ta       g  t            gc       c  t           a  g      a  t ag       a  |      g  a a  c      g  |      a  g a  g      a  |       at gc       t  |       cg gt       a  |       gc ta        ta        at at        cg        tg ta        gc        at cg        cg        gc                         atttttttagcttatctcacaatctgattttaaatgagacaaaggcgataaaaaggcttatactcgaagttggtatttaattttgaggtgatgaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1760 L-serine deaminase ... can be seen here     ..................................................................................................................