                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:51 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-12.60 kcal/mol
Antiterminator: Size=64 nt.     Delta G=-13.44 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCAATGGGTGCAACAAGTTTGAGTGTAGATGCTGTGAAGTCTTTGGCTTCATTGCCT
TCATTAAATGAGTTGCGGGCGAAACTCGTTGGTATGATTTCTACCCCTGCAACCCGTA
TTGCACAGATTGTTAATGCACCTGCTGGTCAAGTTGCACGTGTCATTGGCGCATATGC
TCAGGAGGGTAAAACGGCTTAGgcttgttttgtgttcatgttgatagaagagctatgatgcttttctgttttttttaaataaat
tctaaacaatggttcgaatcttttaattgaaggaattttaaaATG

    rplL Gene: rplL     GI: 49474308     BI number: BQ07140     GOG: COG0222     Description: 50s ribosomal protein l7 /l1 TA T  G Cg Gc |  t Gt Cg At At At At Tg G  t G  g Gt At Gc |  a |  t |  g |  t |  t |  g |  a |  t       tg |  a      a  a |  g      t  t G  a       cg A  a       gc Cg        at Ta        gt Cg        at Gc        at T  |       gc At        at Ta        tg At        at Cg        gt             ttttttaaataaattctaaacaatggttcgaatcttttaattgaaggaattttaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0222 Ribosomal protein L7/L12 ... can be seen here     ..................................................................................................................