                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:80 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -6.30 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -4.74 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G=-15.24 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAAGTTGAAGGGGATCTTCGCCGCGAGGTTGCGGTGAATGTTAAGCGTTTGATGGATC
TTGGTTGCTATCGAGGATTACGTCATCGCCGTTCTCTACCTGTTCGTGGCCAGCGTAC
ACATACAAACGCGCGTACGCGTAAAGGGCCAGCTAAGGCAATTGCCGGTAAGAAAAAA
TAAtagtctttaaaaaagactgttatttttttagatattctatttcttgttgcagttgattagcaagaggaaagtacgtgtaactgctgatgttacgg
cagtgaggagatcgttgaaaggaaaactATG

    rpsK Gene: rpsK     GI: 49474381     BI number: BQ08000     GOG: COG0100     Description: 30s ribosomal protein s1            AT           A  T            CG            GC AA        GC C  A      |  G A  C      |  G T  G      A  T A  C      A  A C  G       TA A  C       CG CG       |  A AT       |  A TA       |  A GC       |  A CG       |  A GC       |  A |  G      |  T        a |  T      |  A      a  a |  A      G  A       ta |  A      A  t       ta |  A      C  a       ta A  G       Cg        cg CG        Gt        ta CG        Gc        gc GC        Gt        at GC        At        tg TA        At        At                         tatttttttagatattctatttcttgttgcagttgattagcaagaggaaagtacgtgtaactgctgatgttacggcagtgaggagatcgttgaaaggaaaactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0100 Ribosomal protein S11 ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_quintana_Toulouse                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:95 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-10.50 kcal/mol Antiterminator: Size=46 nt.     Delta G= -4.74 kcal/mol Anti-antiterminator:   Size=43 nt.     Delta G=-15.24 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AAAGTTGAAGGGGATCTTCGCCGCGAGGTTGCGGTGAATGTTAAGCGTTTGATGGATC TTGGTTGCTATCGAGGATTACGTCATCGCCGTTCTCTACCTGTTCGTGGCCAGCGTAC ACATACAAACGCGCGTACGCGTAAAGGGCCAGCTAAGGCAATTGCCGGTAAGAAAAAA TAAtagtctttaaaaaagactgttatttttttagatattctatttcttgttgcagttgattagcaagaggaaagtacgtgtaactgctgatgttacgg cagtgaggagatcgttgaaaggaaaactATG     rpsK Gene: rpsK     GI: 49474381     BI number: BQ08000     GOG: COG0100     Description: 30s ribosomal protein s1            AT           A  T            CG            GC CA        GC A  T      |  G C  A      |  G A  C      A  T T  A      A  A G  A       TA C  A       CG GC       |  A AG       |  A CC       |  A        a CG       |  A      a  a GC       |  A       ta GG       |  A       ta |  T      |  T       ta |  A      |  A       cg |  C      G  A       ta |  G      A  t       gc |  C      C  a       at T  G       Cg        tg GT        Gt        At CA        Gc        At TA        Gt        Ta TA        At        At GG        At        At                         tttttagatattctatttcttgttgcagttgattagcaagaggaaagtacgtgtaactgctgatgttacggcagtgaggagatcgttgaaaggaaaactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0100 Ribosomal protein S11 ... can be seen here     ..................................................................................................................