                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:57 nt.     Distance to run of Ts=1 nt.   Size=26 nt.     Delta G= -6.80 kcal/mol
Antiterminator: Size=67 nt.     Delta G=-11.00 kcal/mol
Anti-antiterminator:   Size=65 nt.     Delta G= -9.72 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATCGTGAGAAAACAGCACCCCTATCGAAATTTTATTCAGAGAGGGGATTGTTAAAGG
TTGTTGATGGCATGATGGCTGTTACTGAGGTATCACGGGTGATTAGAGGGTTTTTTAA
ATAAggattttttttagaaataaatgaaaagagttgacttttgcggtgaaatctatcaaaaactcttttaatttatttcagtaaaatagtcggattc
ggagaatatttatgccggatcagttttttctataaggtacatcaggtattttatggttaattatcaacataaccaaggagaataggcGTG

    rpsM Gene: rpsM     GI: 49474382     BI number: BQ08010     GOG: COG0099     Description: 30s ribosomal protein s1            ct           a  c at        at a  a       at a  a       at g  a       at at       c  a tg        ta ta        at ta       t  t ta       c  t ta        ta tg        at ta        at tg        at at        gc gt        ta |  g      g  | |  a      g  | gc        cg At        gt At        ta |  t       ta        tt T  t       ta       a  t A  g      |  a       ta A  c      |  t       at A  g       ta       a  g T  g       cg       g  | T  t       at       a  | Tg        gc        gc Ta       |  g       gc Ta        tg        cg Ta        ta        tg Gt        gt        ta Gc        at        at Gt        gc        gc                         agttttttctataaggtacatcaggtattttatggttaattatcaacataaccaaggagaataggcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0099 Ribosomal protein S13 ... can be seen here     ..................................................................................................................