                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:85 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -7.20 kcal/mol
Antiterminator: Size=35 nt.     Delta G= -6.70 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-10.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATTATTGTACTGAAAGAGGCTGGTATTATTCGTCGTCTGAAAGATGGAGTGCGTCTT
CTTTCTGATGGTGAATTGAAAGCAAAGATTACGTTTAATGTTTCTTATACTTCTAAAG
CTGCTCGTATTAAGATTGAAAAAGCTGGTGGTCGCGTTATTGTTCCTGAAGCTGTATG
Ataatctaaggggatgggcttcgttcgaagatatctttttttggagaagtatttaagttttgcatttattatgtatgatagtatcaatttttagagttat
gtgagttaaagaactggagacgttttATG

    secY --- adk Gene: secY     GI: 49474384     BI number: BQ08030     GOG: COG0201     Description: Preprotein translocase secY subunit Gene: adk     GI: 49474383     BI number: BQ08020     GOG: COG0563     Description: Adenylate kinas TA T  T GT CG GT C  T T  | GC        ag GC       a  g T  T       tg G  G       cg G  A       ta TA        at CG       a  g GC       t  |       tt AT       A  |      g  c |  G      G  |       cg |  T      T  |       ta A  A      A  |       ta A  T      T  |       cg A  G      G  |      g  a A  A       Tg       g  | Gt        Cg        gt Ta        Gc        ta Ta        At        at At        At        gc Gc        Gc        gt At        Tg        gt                         tttttggagaagtatttaagttttgcatttattatgtatgatagtatcaatttttagagttatgtgagttaaagaactggagacgttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG0201 Preprotein translocase subunit SecY ... can be seen here [F] COG0563 Adenylate kinase and related kinases ... can be seen here     ..................................................................................................................