Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:89 nt.    Distance to gene:106 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-18.90 kcal/mol
Antiterminator:    Distance from promoter:64 nt. Size=37 nt.     Delta G= -9.20 kcal/mol
Anti-antiterminator:    Distance from promoter:22 nt.    Size=53 nt.     Delta G=-16.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgttg-catagc. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgttgtttagaacattttatttcatagcaggaatatcgcatcgacattatggtcagtgcgagagggcaatcagggaacctcctcccccccccccgcgtg
gatcccttagattgtcgggcctggctgcggatttcctcagtcaggctttttagaattcagtattagtttataggttgaaaattgttttttatcaaaaagt
ctgatgaaaaatgcgttgtgggaatatgctttgtatatcttagttagggagagataATG

    BQ08980


Gene: BQ08980     GI: 49474466     BI number: BQ08980     GOG: -------     Description: hypothetical protei


 ct
c  c
a  c
 at
 gc
 gc
 gc
a  c
c  c       at
t  c      g  t
a  |      a  g
a  |      t  t
c  |      t  c
 gc        cg
 gc        cg
 gc        cg        tt
a  c      t  |      a  t
g  |      a  |       gc
a  |       gc        gc
 gc        gc       c  t
 cg       |  t       gc
 gc       |  g       ta
 tg       |  g       cg
g  t      t  c       gt
a  g       gt        gc
 cg        cg        ta
 ta        gc        cg
 gt        cg        cg
 gc        cg        gc
                        tttttagaattcagtattagtttataggttgaaaattgttttttatcaaaaagtctgatgaaaaatgcgttgtgggaatatgctttgtatatcttagttagggagagataATG


    ..................................................................................................................