                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:117 nt.    Distance to gene:33 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-12.50 kcal/mol
Antiterminator:    Distance from promoter:60 nt. Size=73 nt.     Delta G= -8.40 kcal/mol
Anti-antiterminator:    Distance from promoter:49 nt.    Size=38 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgatg-tatatt. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgatgattaggagcgtaattgtatattttaagcctaaaaatataacagttttctaaatataatcggtgaatgcttcgtatccctttattatttttgtat
ggaaaatagggatgctgtactatataataaaacaattataattttcggattccaaaagtaattttgggagccgtttttctgtttttattaaaccttccgt
gtaacagaaagggacggattATG

    greA --- lpcC Gene: greA     GI: 49474490     BI number: BQ09310     GOG: COG0782,COG1747     Description: Transcription elongation factor greA Gene: lpcC     GI: 49474489     BI number: BQ09300     GOG: COG0438     Description: Lipopolysaccharide core biosynthesis mannosyltransferase lpc            aa           a  c           a  a            ta            at            at            ta            at            ta           a  a           t  t           c  t           a  t           t  t            gc            tg            cg           g  |            ta            at            gt   a        gc t  t       gc g  g      a  | tg       t  | ta       a  | ta       a  | ta       a  | ta       a  | at       g  |       ta t  |      g  |      g  a t  |      t  |       at a  |      a  |       at t  |      t  |       at t  |      g  |       at ta        ta        cg cg        ta        cg cg        ta        tg cg        ta        ta ta        tg       a  g at        at        gc tg        ta        gc gc        ta        cg                         tttttctgtttttattaaaccttccgtgtaacagaaagggacggattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0782 Transcription elongation factor ... can be seen here [S] COG1747 Uncharacterized N-terminal domain of the transcription elongation factor GreA ... can be seen here [M] COG0438 Glycosyltransferase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_quintana_Toulouse                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:50 nt.    Distance to gene:42 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-12.50 kcal/mol Antiterminator:    Distance from promoter:16 nt. Size=73 nt.     Delta G= -8.40 kcal/mol Anti-antiterminator:    Distance from promoter:13 nt.    Size=45 nt.     Delta G= -7.60 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: gtgaat-tatttt. It has a score value of 69.61 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case gtgaatgcttcgtatccctttattatttttgtatggaaaatagggatgctgtactatataataaaacaattataattttcggattccaaaagtaattttg ggagccgtttttctgtttttattaaaccttccgtgtaacagaaagggacggattATG     greA --- lpcC Gene: greA     GI: 49474490     BI number: BQ09310     GOG: COG0782,COG1747     Description: Transcription elongation factor greA Gene: lpcC     GI: 49474489     BI number: BQ09300     GOG: COG0438     Description: Lipopolysaccharide core biosynthesis mannosyltransferase lpc            aa           c  a           c  a            tg            tt            aa            ga            g            c           t           t           t           t           a            a            t            a           t  |            t            a aa        a a  c       c a  a       a ta       a  | at       a  | at       a  | ta       t  | at       a  | ta       a  | a  a      t  |       ta t  t      a  |      g  a c  t      t  |       at a  t      a  |       at t  t      t  |       at gc       c  |       at tg        a        cg cg        t        cg g  |       g        tg ta        t        ta at        c       a  g gt        g        gc gc        t        gc gc        a        cg                         tttttctgtttttattaaaccttccgtgtaacagaaagggacggattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0782 Transcription elongation factor ... can be seen here [S] COG1747 Uncharacterized N-terminal domain of the transcription elongation factor GreA ... can be seen here [M] COG0438 Glycosyltransferase ... can be seen here     ..................................................................................................................