                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:68 nt.    Distance to gene:21 nt.     Distance to run of Ts=3 nt.   Size=24 nt.     Delta G= -9.80 kcal/mol
Antiterminator:    Distance from promoter:11 nt. Size=64 nt.     Delta G=-14.86 kcal/mol
Anti-antiterminator:    Distance from promoter:16 nt.    Size=25 nt.     Delta G= -5.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGGAA-TACAAT. It has a score value of 74.3 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGAATACTTTTAGACTTTACTACAATGATGCAGAAAAGTACGCGCAGTTACAGGAA
TAAagattgcgggggctatttgattgtaatgtttgactgtgtggcaaggggggatgctacactaatattttagatgtgtaggatcttatcaagATG

    BQ09560 --- BQ09550 --- oppD --- BQ09530 Gene: BQ09560     GI: 49474513     BI number: BQ09560     GOG: COG0601     Description: ABC transporter permease protein Gene: BQ09550     GI: 49474512     BI number: BQ09550     GOG: COG1173     Description: ABC transporter, permease protein Gene: oppD     GI: 49474511     BI number: BQ09540     GOG: COG0444     Description: Oligopeptide transport ATP-binding protein Gene: BQ09530     GI: 49474510     BI number: BQ09530     GOG: COG4608     Description: ABC transporter, ATP-binding protei            gg           g  g            cg            gc           t  t            ta            at            gt            at           |  g           A  a           A  t           T  t           A  g           A  t           G  a           G  a            At            Cg            At           |  t   A       |  t G  A       Tg        gg G  T       Ta       g  g A  A       Gc       g  g C  A       At       a  a A  a       Cg        at Tg        Gt        cg Ta        Cg        gc Gt        Gt        gt At        Cg        ta Cg       A  |       gc Gc        Tg        ta Cg        Gc        gc                         taatattttagatgtgtaggatcttatcaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EP] COG0601 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG1173 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG0444 ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component ... can be seen here [E] COG4608 ABC-type oligopeptide transport system, ATPase component ... can be seen here     ..................................................................................................................