Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:190 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -6.10 kcal/mol
Antiterminator: Size=28 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-18.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGCACGTTCAACATTGGCTGAAGCAATGGCTGCGGTTTCTCGGATGAATGAGAGGCG
CATTGAGGCAGCAGCCGATATTTGGTTAGCACGGCAAAAAGATCGTGCTCTTTTGGAT
GTACGCTTTGACTTGATCGCGATTTTGCCGTGGCGTTTGCCGCAGCATATTCCCGCAT
TTTTTACGTCTGATAAATAAgagtttttatagcgttttaccatggtaaatgaaaaatatttcgtttttatgagcatatggggtaa
acaaagtgcgtgacagtttgagcaaggatgaggagcaaaagATG

    BQ09710


Gene: BQ09710     GI: 49474525     BI number: BQ09710     GOG: -------     Description: hypothetical protei


 TG
A  A
G  A
 GT
 CG
 TA
 CG
 TA
 TG
 TG
 GC
|  G
|  C
|  A        A
|  T      T  T
|  T       AT
|  G       GT
|  A       CG
|  G       CG
|  G       GT        AA
|  C       AT       A  A
G  A      |  A      A  G
 CG        CG       C  A
 GC        GC        GT
 TA       |  A       GC
 CG       |  C       CG
 GC       A  G       AT
 GC        CG        CG
 TG        GC        GC
                        TCTTTTGGATGTACGCTTTGACTTGATCGCGATTTTGCCGTGGCGTTTGCCGCAGCATATTCCCGCATTTTTTACGTCTGATAAATAAgagtttttatagcgttttaccatggtaaatgaaaaatatttcgtttttatgagcatatggggtaaacaaagtgcgtgacagtttgagcaaggatgaggagcaaaagATG
    ..................................................................................................................