Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:167 nt.    Distance to gene:20 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-11.20 kcal/mol
Antiterminator:    Distance from promoter:167 nt. Size=15 nt.     Delta G= -3.90 kcal/mol
Anti-antiterminator:    Distance from promoter:103 nt.    Size=68 nt.     Delta G=-10.57 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTAATA-TACAAT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTAATAATGGACTTGTTCAACGTACAATAGCTGGAAAGCAAAACCAAATTATTTATCT
AGACTCTTGGAATTGGTATCGAGCTAGTGGTGGTCTAACTGGGCTTAACGAAACAGCT
CAACAACTCAATAAAGCCTTTACAACAAGCAAATAAgtgcacaaacatttacttgtctaatcatgaaataaag
ttttaagggtggaagttgcccatgaaagacttctgctcttttctgttaggaaataatttaacGTG

    fatD


Gene: fatD     GI: 49474564     BI number: BQ10310     GOG: COG4606     Description: Ferric anguibactin transport system permease protei


 ca
a  a
c  a
 gc
 ta
 gt
 At
 At
 Ta
A  c
 At
 At
 Cg
 Gt
|  c
|  t
|  a
|  a
|  t
|  c
|  a
|  t
|  g
|  a
|  a
|  a                 at
|  t                c  g
|  a                c  a
A  a                c  a
A  a                g  a
 Cg                  tg
 At                  ta
 At                  gc
C  t        a        at
 At       a  g       at
 Ta       g  t       gc
 Ta       g  t      g  t
 Tg        tg       t  g
 Cg        gc        gc
 Cg        gc        gt
 Gt        gc        gc
                        ttttctgttaggaaataatttaacGTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[P] COG4606 ABC-type enterochelin transport system, permease component ... can be seen here

    ..................................................................................................................