                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:56 nt.     Distance to run of Ts=1 nt.   Size=37 nt.     Delta G=-11.40 kcal/mol
Antiterminator: Size=65 nt.     Delta G= -5.44 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACATAATGGGGCTGTTGGAAAACAGAAACTTTTTTGCGTAAACCAGACGTTCCAGGT
TTTTGATCATTAAAAGCCGTAGTCAAAACTGTCATGATAGTCATggaagcgccttcatcttgttttg
tttgattctagagtaaacatctatcaaagtcgaccattaattctacttgacgcaacaatgaaatacttgcaaactcgttagaaaagaagactgtttaagt
cgttcttttcaatatattttaaagacgaggacttttttaaaacacaattttcataaaaaatacaggagcataattATG

    BQ10800 Gene: BQ10800     GI: 49474601     BI number: BQ10800     GOG: COG0678     Description: hypothetical protei   a g  a t  a a  t a  a c  c at at cg gc |  a |  a |  a c  c at gc tg t  t        t c  |      t  t at       g  a ta        ta cg        cg ta        at ta        gc a  a      |  g a  a       at t  g       at t  a       gc a  a       at c  |       at c  |       at a  |       at g  |       gc cg       a  | ta        ta gc        ta at        gt             atattttaaagacgaggacttttttaaaacacaattttcataaaaaatacaggagcataattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0678 Peroxiredoxin ... can be seen here     ..................................................................................................................