Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:80 nt.     Distance to run of Ts=1 nt.   Size=37 nt.     Delta G=-14.60 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -6.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGAAATATCAGCAATCAGTGCTTCCAACATTGCTGACACATAAGCGTCACCGGATGAT
TGGCTACCTGTGACAGATCGGGCAAAACGTCGAAGATAGGGGAGATGCGGTGCGATGC
GCGTTGATAATGACATgatttataactcctttgacctttgaagcattttgttgattgaaatcctcaacagaggaaaaagttcctctgt
tcgtatggaactttttacatacaaccatatttacaactataaggcgaaaaattgttctagctgctagtgatattatatggattagggggacaaaaaATG


    BQ10970 --- sigH


Gene: BQ10970     GI: 49474608     BI number: BQ10970     GOG: -------     Description: hypothetical protein
Gene: sigH     GI: 49474607     BI number: BQ10960     GOG: COG1595     Description: RNA polymerase sigma factor, ecr subfamil



  a
a  a
g  t
t  c
t  c       aa
 at       a  g
 gc        at
 ta        at
 ta        gc
 gc        gc
 ta        at
 tg        gc
 ta        at
 tg        cg
a  g       at
c  a       at
g  a      |  c
a  |      |  g
a  |      |  t
g  |      c  a
 ta       t  t
 ta        cg
 ta        cg
 cg        ta
            actttttacatacaaccatatttacaactataaggcgaaaaattgttctagctgctagtgatattatatggattagggggacaaaaaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG1595 DNA-directed RNA polymerase specialized sigma subunit, sigma24 homolog ... can be seen here

    ..................................................................................................................