                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:160 nt.     Distance to run of Ts=3 nt.   Size=30 nt.     Delta G= -7.80 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -6.80 kcal/mol
Anti-antiterminator:   Size=63 nt.     Delta G= -7.06 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCAGGCAGTGCTTCTTCCTGAATTTCCAAATAAAACTGGCGTAATTTCCGTGCTATT
TCGCTGTTGACCCCGAGAAGATCATCTCCAAATGTAAAGTGATTGGTGAGATTTTTTT
CATCACAGTCGTTCATtttttgtccccctaatccatataatatcactagcagctagaacaatttttcgccttatagttgtaaatatgg
ttgtatgtaaaaagttccatacgaacagaggaactttttcctctgttgaggatttcaatcaacaaaatgcttcaaaggtcaaaggagttataaatcATG

    BQ10980 --- BQ10990 Gene: BQ10980     GI: 49474609     BI number: BQ10980     GOG: -------     Description: Sensory transduction regulatory protein Gene: BQ10990     GI: 49474610     BI number: BQ10990     GOG: COG3920     Description: Sensory transduction histidine kinas   G C  T C  G T  C T  T TA AT AT T  T GC CG GC GT T  |        A CG       A  A AT       T  G AT       G  T |  G      T  G       TT A  A      A  A      T  T A  C       AT        AT T  C       AT        GT A  C       CG        AT A  C       CG        GC A  G      T  T       TA C  A       CG        GT CG        TA        GC TA       A  |       TA TA        CG       |  C TG        TA       |  A A  A       AT        TG AT        GT        AT GC        AT        GC TA        AT        TG                         TTCATtttttgtccccctaatccatataatatcactagcagctagaacaatttttcgccttatagttgtaaatatggttgtatgtaaaaagttccatacgaacagaggaactttttcctctgttgaggatttcaatcaacaaaatgcttcaaaggtcaaaggagttataaatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG3920 Signal transduction histidine kinase ... can be seen here     ..................................................................................................................