Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:23 nt.     Distance to run of Ts=0 nt.   Size=15 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=21 nt.     Delta G= -4.10 kcal/mol
Anti-antiterminator:   Size=62 nt.     Delta G= -8.55 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gcttggaaaaagatcattgaagcagaaagagcaagaaaaacctctcaacgcaaaagtgcagggagaacacttttcaaggcaggaacgagagaaataaaac
atttcaaagcaaagatgcaatgagaatacttttaaaagcaggaaagagagagcaaatctctcaaagggggagggaaaagctacaaacaaaaaccataaaa
aacatagaaaaatggtccgccatttgaaaacaaaaaatggggaatgtcaataaccggcgttttgccggcttttttatttcaataattttaagaggttaaa
ATG

    BQ11110


Gene: BQ11110     GI: 49474622     BI number: BQ11110     GOG: -------     Description: hypothetical protei


 cc
t  g
 gc
 gc
 ta
 at
 at
 at
a  g
a  a
g  a
a  a
t  a
a  c
c  a
a  a
a  a
a  a
a  a
a  |
a  |
 ta         a
 at       t  a
 cg       a  c
 cg       a  c        t
a  g       cg       t  t
a  g       tg       g  t
a  a       gc        cg
a  a       tg        gc
 at        at        gc
 cg        at        cg
 at        gt        cg
                        cttttttatttcaataattttaagaggttaaaATG


    ..................................................................................................................