                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:118 nt.    Distance to gene:74 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-15.50 kcal/mol
Antiterminator:    Distance from promoter:100 nt. Size=31 nt.     Delta G= -8.10 kcal/mol
Anti-antiterminator:    Distance from promoter:73 nt.    Size=40 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgata-AAAATT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgataaacggtgagtatgATGAAAATTAAAAATTCGCTTAAAGCACTGAGAGAACGTCACCGTAA
CAATCGTATGGTGCGTCGTAAGGGTCGTGTTTATATCCTGAACAAAACGAATCCCCGT
TTTAGAGCGCGTCAGGGCTGAtggtttttgtgcttgcttttttgcgggcattaaacctttttcgtttcgttggaggtttgtcttt
aggattgcaagtcccttgtttgatatctcattttttgacgacttgtttttATG

    BQ11320 Gene: BQ11320     GI: 49474637     BI number: BQ11320     GOG: -------     Description: hypothetical signal peptide protei TC A  C A  C GC CG AT                  tt AT         A       t  t AT       G  t      t  t AT       T  g       cg |  A       Cg        gc |  G       Gt        tg |  A       Gt        tg |  G       Gt        cg |  C       At        gc |  G      C  |       ta C  C      T  |       gt A  G       Gt       t  t AT        Cg       t  | GC        Gt        ta TA        Cg        ta CG        Gc        ta CG        At        gc TG        Gt        gc                         tttttcgtttcgttggaggtttgtctttaggattgcaagtcccttgtttgatatctcattttttgacgacttgtttttATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_quintana_Toulouse                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:100 nt.    Distance to gene:92 nt.     Distance to run of Ts=1 nt.   Size=31 nt.     Delta G= -8.10 kcal/mol Antiterminator:    Distance from promoter:73 nt. Size=40 nt.     Delta G= -8.50 kcal/mol Anti-antiterminator:    Distance from promoter:61 nt.    Size=25 nt.     Delta G= -3.30 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgata-AAAATT. It has a score value of 60.91 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgataaacggtgagtatgATGAAAATTAAAAATTCGCTTAAAGCACTGAGAGAACGTCACCGTAA CAATCGTATGGTGCGTCGTAAGGGTCGTGTTTATATCCTGAACAAAACGAATCCCCGT TTTAGAGCGCGTCAGGGCTGAtggtttttgtgcttgcttttttgcgggcattaaacctttttcgtttcgttggaggtttgtcttt aggattgcaagtcccttgtttgatatctcattttttgacgacttgtttttATG     BQ11320 Gene: BQ11320     GI: 49474637     BI number: BQ11320     GOG: -------     Description: hypothetical signal peptide protei            TC           A  C           A  C            GC            CG            AT            AT         A            AT       G  t            AT       T  g           |  A       Cg   T       |  G       Gt A  C      |  A       Gt T  C      |  G       Gt AT       |  C       At TG       |  G      C  | TA       C  C      T  | TA       A  G       Gt GC        AT        Cg TA        GC        Gt G  A       TA        Cg C  A       CG        Gc TA        CG        At GC        TG        Gt                         gcttttttgcgggcattaaacctttttcgtttcgttggaggtttgtctttaggattgcaagtcccttgtttgatatctcattttttgacgacttgtttttATG     ..................................................................................................................