                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:12 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-12.60 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -7.80 kcal/mol
Anti-antiterminator:   Size=25 nt.     Delta G=-10.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

agggatcgtttagtaaaaggagaatacattaaattttctccattcacccacaccgttcttcacccttctgttcactccgtcagcaaccacccttagcgaa
gcaggcccctcaccgacaactgcctcaccggcactccaccaagccctcacctcaccaggcttcctcaccaaacaaccaacctcgtggcttaatctttaca
aaattccatttcttttctgcttttgaagagcaggaaaatccagttttaaagtcggtcattcagctctgctttgtgcagggctttttttatggagaaattt
ATG

    BQ11590 Gene: BQ11590     GI: 49474656     BI number: BQ11590     GOG: COG3772     Description: phage related lysozym            ta           t  a            ta            tg           g  t           a  c            cg            cg   g       t  t t  a      a  c t  a      a  a        t tg        at       t  g ta        at       t  t cg        gc        cg gc       g  a       gc ta       a  |       ta cg        cg        cg tg        gc        tg ta        at        cg ta        gc        gc ta        at        at                         ttttttatggagaaatttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3772 Phage-related lysozyme (muraminidase) ... can be seen here     ..................................................................................................................