                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:20 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-11.60 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -4.10 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G= -3.86 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTTTTGTAAAAAAAATGCATCATCCTTAAAACCTTGAGAATCATAGAGAATAACACA
CGCAAAAGACTTTGTTTGCAAGATTTGGCGCAAAAAGGTGGGCTCTAAAATACGCTGA
ACATCTAATGTCAAAACCAATTGAGGATAAGAAGGAGACTCAATCGATTTACTCTTTT
GTTTTGTCATacaaaatccttatctctgaaaaagaaacttgacacttaaaaattaaagtttcatcctaacgcagggttctttgttgaaagggg
ccgaactgcttttgtgacttggaggggcccattATG

    opgC Gene: opgC     GI: 49474680     BI number: BQ11910     GOG: COG4645     Description: opgC protei                       t             c       t  g           a  g      g  a   a       a  c       ta t  a       ta        ta t  a       cg        tg c  a       cg        cg a  a       tg        tg c  t       at        tg a  t      c  t       gc g  a      t  |       gc ta       t  |      |  g ta       t  |      |  a cg        gc       |  a at        at        gc at        at        at at        at        cg gc        tg        gc                         ttttgtgacttggaggggcccattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4645 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................