                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:192 nt.     Distance to run of Ts=1 nt.   Size=33 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=65 nt.     Delta G=-13.00 kcal/mol
Anti-antiterminator:   Size=60 nt.     Delta G= -6.66 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGCTGGGTGTTTGTTTAGTATCATCGGTTTTTCTGATTTAAAAGGATTAACCCTTTC
AGGTGTGAAATGGCCTATTTGTGATAAAAATGTGTCATTTGGCTCTTCTTTAACACTT
TCTAACCGTATTTATGGAACCTTCTCTTGTCATTTATGTTCTGGAAAAGCTATATTGT
TGGCATCTGTACCTATTCCATAAaactcttccagtatatttataatgcagaagggggagataagtgatgaagtgccagcgtga
ataatatacttatgttttgatcttgagaaggagaggtttttatATG

    BQ12090 --- BQ12080 Gene: BQ12090     GI: 49474696     BI number: BQ12090     GOG: -------     Description: hypothetical protein Gene: BQ12080     GI: 49474695     BI number: BQ12080     GOG: COG0488     Description: ABC transporter, ATP-binding protei            TA           T  A           A  C   G        GC T  T       GC A  A       AT t  T       AT a  C       AT t  A      A  C t  T       TA t  C       TG tG        TG tG        AT g  T      G  G g  T      T  T aT        CG gT        TA aT        TA        AA gC        TA       A  T gT       |  T      A  G |  G       TG        AT a  A       TG        TG aT        GC        AT gT        GC        GC aT       |  T       TA |  A      |  A       GT |  A      |  T      T  T g  A      |  T      T  T tA       C  T      T  | tG        TG       A  | cG        AT       T  | tA        CG        CG aT        TA        CG gT        AT        GC tA        TA        GT                         CTTCTTTAACACTTTCTAACCGTATTTATGGAACCTTCTCTTGTCATTTATGTTCTGGAAAAGCTATATTGTTGGCATCTGTACCTATTCCATAAaactcttccagtatatttataatgcagaagggggagataagtgatgaagtgccagcgtgaataatatacttatgttttgatcttgagaaggagaggtttttatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0488 ATPase components of ABC transporters with duplicated ATPase domains ... can be seen here     ..................................................................................................................