Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:138 nt.    Distance to gene:22 nt.     Distance to run of Ts=2 nt.   Size=30 nt.     Delta G=-12.20 kcal/mol
Antiterminator:    Distance from promoter:107 nt. Size=46 nt.     Delta G= -4.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tgcaca-taaaaa. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgcacattgcatagactctttattaaaaaatcgatttctctttatttatacttaaacctattgtatgccggagcccctgttaaagccacacaaaaaatta
aatgaacgtctagtcaaaaggctttaatcagtgtataacgccatcaaattttatgatattttttaataaaagcattgtcgtttttgacattgctttttct
gttttaatggatttggagtgtctctttATG

    rpmF


Gene: rpmF     GI: 49474703     BI number: BQ12160     GOG: -------     Description: 50s ribosomal protein l3


  t
t  t
a  t
t  t
a  t
g  a
 ta
 at
 ta
 ta        tt
 ta       t  t
 ta        gt
a  g       cg
a  c       ta
a  a       gc
c  t       ta
t  |      t  t
 at        at
 cg        cg
c  t       gc
 gc        at
 cg        at
 at        at
 at        at
            tctgttttaatggatttggagtgtctctttATG


    ..................................................................................................................