                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:175 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -6.10 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -9.80 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -9.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACAAAATGGGATAGTCTAGAGCAGCTTGAAAATATTCACTACTTGCTAAAGGAACCCA
GTGAGTATCCTTGGCGAAAGACATATCGCTTGGAGGAGCAAACTTTAGGTTTTTATGG
GAAACTTTGTTGATTGGGGTAATATCTTTGTAGAAAAGCATAACATTTGCCATaagacttc
tccttttattaatttgtttttgttaccaagaaaggtctttctggaagatttttaatatggcaacaaaatttaatagaaagttacgagactgagagattcg
cttttaaaagacggtattttcgtATG

    rimM --- trmD Gene: rimM     GI: 49474760     BI number: BQ12750     GOG: COG0806     Description: 16s rRNA processing protein rimM Gene: trmD     GI: 49474759     BI number: BQ12740     GOG: COG0336     Description: tRNA (guanine-n1)-methyltransferas CT G  A TA TA CG |  G |  A |  A |  C |  C A  C TA CG        AC AT       G  A CG       A  T TA       A  A TG        AT         C AT        GC       G  A TA        CG       A  A AT        GC       G  A A  C       GT        GC A  C      |  T       AT A  T      |  G       GT G  T       TG        GT T  |       TA        TA TG        CG        TG CG        CG        CG GC        TA        GT                         TTTTATGGGAAACTTTGTTGATTGGGGTAATATCTTTGTAGAAAAGCATAACATTTGCCATaagacttctccttttattaatttgtttttgttaccaagaaaggtctttctggaagatttttaatatggcaacaaaatttaatagaaagttacgagactgagagattcgcttttaaaagacggtattttcgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0806 RimM protein, required for 16S rRNA processing ... can be seen here [J] COG0336 tRNA-(guanine-N1)-methyltransferase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_quintana_Toulouse                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:188 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -6.10 kcal/mol Antiterminator: Size=30 nt.     Delta G= -9.80 kcal/mol Anti-antiterminator:   Size=23 nt.     Delta G= -3.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ACAAAATGGGATAGTCTAGAGCAGCTTGAAAATATTCACTACTTGCTAAAGGAACCCA GTGAGTATCCTTGGCGAAAGACATATCGCTTGGAGGAGCAAACTTTAGGTTTTTATGG GAAACTTTGTTGATTGGGGTAATATCTTTGTAGAAAAGCATAACATTTGCCATaagacttc tccttttattaatttgtttttgttaccaagaaaggtctttctggaagatttttaatatggcaacaaaatttaatagaaagttacgagactgagagattcg cttttaaaagacggtattttcgtATG     rimM --- trmD Gene: rimM     GI: 49474760     BI number: BQ12750     GOG: COG0806     Description: 16s rRNA processing protein rimM Gene: trmD     GI: 49474759     BI number: BQ12740     GOG: COG0336     Description: tRNA (guanine-n1)-methyltransferas            GA           T  G           G  T           A  A tA        CT         C g  T       CC       G  A cG        CC       A  A tA        AT       G  A tA        AT        GC tA       |  G       AT tG       |  G       GT |  G       GC        GT a  A       GG        TA tA        AA        TG gC        AA        CG gC        AA        GT                         TTTTATGGGAAACTTTGTTGATTGGGGTAATATCTTTGTAGAAAAGCATAACATTTGCCATaagacttctccttttattaatttgtttttgttaccaagaaaggtctttctggaagatttttaatatggcaacaaaatttaatagaaagttacgagactgagagattcgcttttaaaagacggtattttcgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0806 RimM protein, required for 16S rRNA processing ... can be seen here [J] COG0336 tRNA-(guanine-N1)-methyltransferase ... can be seen here     ..................................................................................................................