                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:54 nt.    Distance to gene:147 nt.     Distance to run of Ts=1 nt.   Size=35 nt.     Delta G=-12.70 kcal/mol
Antiterminator:    Distance from promoter:42 nt. Size=33 nt.     Delta G=-11.20 kcal/mol
Anti-antiterminator:    Distance from promoter:20 nt.    Size=40 nt.     Delta G=-13.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAGA-AATGAT. It has a score value of 69.61 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAGAAAATTTTATCAACATGCAATGATGTTGTTTTAGAGCCTATTTGTGCAGAAGA
AATGGGTGCACTGGCGCATTTGCTTTCTGCGAAGGGGATTTTGCGCACGACCCCTGCA
GACTTTTGTCATGAAAATTTTGATGCTGAGAAAAAAATGTTTTTAGGAATGGATGGTT
TTTTTACAGCGCGTTTCCGGAAAGTAAATTAAtttaacgattcatttactaaaatggctgaagttatgctcaatta
ggcatatacggagacaagattGTG

    BQ12880 Gene: BQ12880     GI: 49474770     BI number: BQ12880     GOG: COG5360     Description: hypothetical protei CT                  GC A  G                C  A CG         G        GC GC       T  C       TG TG        CG        TA GC        TA       T  | G  A       TA       T  | G  T       TG       A  | T  T       CG        GC A  T      G  G       GC A  G       TG        GC A  C       TA        GC GT       |  T       AT AT       |  T      A  | AT       T  T      G  | GC        AT        CG AT        CG        GC CG        GC        TA GC        CG        CG TG        GC        TA                         CTTTTGTCATGAAAATTTTGATGCTGAGAAAAAAATGTTTTTAGGAATGGATGGTTTTTTTACAGCGCGTTTCCGGAAAGTAAATTAAtttaacgattcatttactaaaatggctgaagttatgctcaattaggcatatacggagacaagattGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG5360 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................