Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:116 nt.    Distance to gene:22 nt.     Distance to run of Ts=1 nt.   Size=31 nt.     Delta G=-10.70 kcal/mol
Antiterminator:    Distance from promoter:66 nt. Size=68 nt.     Delta G=-10.91 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-TTTAAT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAAATGCATTGCGACAGATTTTTAATGTATCTACCGTACATGCGTGAgtgttaagaaaac
tatgaccatgttgattggtatcatgagataaggaaagtttaaagtttgtttatattctctcaattgaaatcactccgaaaaagcctttctttaagctttc
tgctttggggggtgttttgtcttattttgatactaatttatagctcaatCTG

    BQ12970


Gene: BQ12970     GI: 49474778     BI number: BQ12970     GOG: COG4093     Description: hypothetical protei



  a
g  a
t  a
t  t
a  c
a  a
c  c
t  t
c  c
t  c
 cg
 ta
 ta
a  a
t  |
a  |
 ta
 ta
 tg
 gc         t
|  c      t  c
t  t      t  t
t  t       cg
t  t       gc
 gc        at
 at        at
 at       t  t
 at       t  |
 ta       t  |
 ta        cg
 tg        tg
 gc        tg
 at        tg
 at        cg
 at        cg
 gc        gt
            gttttgtcttattttgatactaatttatagctcaatCTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG4093 Uncharacterized protein conserved in bacteria ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in B_quintana_Toulouse

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:116 nt.    Distance to gene:30 nt.     Distance to run of Ts=1 nt.   Size=31 nt.     Delta G=-10.70 kcal/mol
Antiterminator:    Distance from promoter:84 nt. Size=68 nt.     Delta G=-10.91 kcal/mol
Anti-antiterminator:    Distance from promoter:54 nt.    Size=47 nt.     Delta G= -3.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-TTTAAT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAAATGCATTGCGACAGATTTTTAATGTATCTACCGTACATGCGTGAgtgttaagaaaac
tatgaccatgttgattggtatcatgagataaggaaagtttaaagtttgtttatattctctcaattgaaatcactccgaaaaagcctttctttaagctttc
tgctttggggggtgttttgtcttattttgatactaatttatagctcaatCTG

    BQ12970


Gene: BQ12970     GI: 49474778     BI number: BQ12970     GOG: COG4093     Description: hypothetical protei


            c
          c  t
          g  t
          a  t
          a  c
          a  t
          a  t
          a  t
          g  a
 ta       c  a
t  a       cg
t  a       tc
g  g       ct
 at       a  t
 at       c  |
 at       t  |
g  g       at
 gt        ac
 at        a
 at        g         t
 ta       |        t  c
|  t      t        t  t
|  a      t         cg
|  t      a         gc
|  t       a        at
|  c       c        at
 at        t       t  t
 gc        c       t  |
 at        t       t  |
 gc        c        cg
 ta        t        tg
|  a       t        tg
|  t       a        tg
 at        t        cg
 cg        a        cg
 ta        t        gt
                        gttttgtcttattttgatactaatttatagctcaatCTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG4093 Uncharacterized protein conserved in bacteria ... can be seen here

    ..................................................................................................................