Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:89 nt.     Distance to run of Ts=1 nt.   Size=25 nt.     Delta G= -8.20 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -8.36 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-24.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCAAACAGATCCTGCACACGATGAAAACCGAAAACCCGCCACTCTGGATTCCAGCCA
CCCTGGATGCGACGGTGTTCTATTACATCCGTCGTTTGCTGCCTCGCCGGGTGCTTTT
GCCGTTCCTGTACTGGTGCCTGCCAGGGGCGCGGCATTGGGCCAAAGAGCACACCCAC
AGACGATCCTAAggccgaactggaccttggacttgtttggggctttggggttgagttcccgttaacctcttgatggactgaagtcgtcttc
aatatagagacctttgaaaagcatggaggctgatcATG

    Bd0036


Gene: Bd0036     GI: 42521684     BI number: Bd0036     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic


 CC
G  T
 TG
 GC
 GC
 TA
 CG        AC
A  |      C  C
T  |      A  C
G  |      C  A
 TG       G  C
 CG       A  A
 CG       G  G
T  C      A  A
 TG       A  C        a
 GC       A  G      a  c
 CG       C  A      g  t
 CG       C  T       cg
 GC        GC        cg
 TA        GC       |  a
T  T       GT        gc
T  T       TA        gc
 TG        TA        At
 CG       A  g       At
G  |       Cg       T  |
 TG        Gc        Cg
 GC        Gc        Cg
 GC        Cg        Ta
                        cttgtttggggctttggggttgagttcccgttaacctcttgatggactgaagtcgtcttcaatatagagacctttgaaaagcatggaggctgatcATG
    ..................................................................................................................